Stem-loop sequence oan-mir-32

AccessionMI0006952 (change log)
DescriptionOrnithorhynchus anatinus miR-32 stem-loop
Gene family MIPF0000069; mir-32
Stem-loop
   uuc  auuc   --ua    ug                 u            - uu  c 
5'    cc    ugc    gcuc  guggagauauugcacau acuaaguugcau g  gu a
      ||    |||    ||||  ||||||||||||||||| |||||||||||| |  ||  
3'    gg    acg    ugag  cacuuuuauagcgugug ugauuuaacgug c  cg a
   guu  cccc   uacg    ua                 -            u uc  g 
Get sequence
Deep sequencing
1650 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
X3: 5770613-5770728 [-]
sense
ENSOANT00000002777 ; TMEM245-201; intron 14
Database links

Mature sequence oan-miR-32-5p

Accession MIMAT0007268
Previous IDsoan-miR-32
Sequence

28 - 

uauugcacauuacuaaguug

 - 47

Get sequence
Deep sequencing1573 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-miR-32-3p

Accession MIMAT0007269
Previous IDsoan-miR-32*
Sequence

69 - 

caauuuagugugugcgauauu

 - 89

Get sequence
Deep sequencing33 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).