Stem-loop sequence gga-mir-1397

AccessionMI0006980 (change log)
DescriptionGallus gallus miR-1397 stem-loop
Gene family MIPF0000642; mir-1397
Stem-loop
   agcuguugacugaaugcgaugugugcauugcauu   ac           cuaau 
5'                                   gcg  ggguuauauca     c
                                     |||  |||||||||||      
3'                                   cgc  cccaauguagu     g
   -------uugcaaagugcugcgaauguaguacga   aa           acaau 
Get sequence
Deep sequencing
273 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 126961688-126961792 [+]
sense
ENSGALT00000026841 ; NLGN4-201; intron 1
ENSGALT00000026840 ; NLGN4-202; intron 1
ENSGALT00000045890 ; NLGN4-203; intron 1
Database links

Mature sequence gga-miR-1397-5p

Accession MIMAT0007283
Previous IDsgga-miR-1397
Sequence

29 - 

ugcauugcgacggguuauauca

 - 50

Get sequence
Deep sequencing190 reads, 3 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

Mature sequence gga-miR-1397-3p

Accession MIMAT0007284
Previous IDsgga-miR-1397*
Sequence

64 - 

gauguaacccaacgcagcauga

 - 85

Get sequence
Deep sequencing79 reads, 2 experiments
Evidence experimental; cloned [1], Illumina [2]
Predicted targets

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
2
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).