Stem-loop sequence oan-mir-1421ab-2

AccessionMI0006999 (change log)
DescriptionOrnithorhynchus anatinus miR-1421ab-2 stem-loop
Gene family MIPF0000564; mir-1421
Stem-loop
   -  --u   gua      g     a        c    c     ga  gaug 
5'  gg   gac   cggcac gugug ggagcuca acgu uugca  gu    u
    ||   |||   |||||| ||||| |||||||| |||| |||||  ||    c
3'  cc   cug   gucgug cacau ccucgagu ugcg aacgu  cg    g
   g  uuu   --g      a     g        c    u     ag  aaag 
Get sequence
Deep sequencing
10052 reads, 3.04e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
X1: 44293810-44293911 [-]
antisense
Clustered miRNAs
< 10kb from oan-mir-1421ab-2
oan-mir-1421ag-2X1: 44303617-44303684 [-]
oan-mir-1421y-3X1: 44303056-44303140 [-]
oan-mir-1421aiX1: 44301501-44301574 [-]
oan-mir-1421ab-1X1: 44298540-44298604 [-]
oan-mir-1419dX1: 44298117-44298229 [-]
oan-mir-1419c-2X1: 44296776-44296886 [-]
oan-mir-1421ag-1X1: 44295490-44295574 [-]
oan-mir-1421y-2X1: 44294920-44295029 [-]
oan-mir-1421ab-2X1: 44293810-44293911 [-]
oan-mir-1421aaX1: 44291691-44291783 [-]
oan-mir-1419c-1X1: 44291006-44291114 [-]
oan-mir-1421zX1: 44289986-44290072 [-]
oan-mir-1419b-2X1: 44286185-44286299 [-]
oan-mir-1421y-1X1: 44284866-44284978 [-]
oan-mir-1421xX1: 44284340-44284425 [-]
Database links

Mature sequence oan-miR-1421ab-5p

Accession MIMAT0007251
Previous IDsoan-miR-1421ab
Sequence

22 - 

aggagcucacacgucuugcaga

 - 43

Get sequence
Deep sequencing18628 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-1421ab-2-3p

Accession MIMAT0007300
Previous IDsoan-miR-1421ab-2*
Sequence

61 - 

ugcaaugcgucugagcuccgu

 - 81

Get sequence
Deep sequencing726 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).