Stem-loop sequence oan-mir-1420g

AccessionMI0007018 (change log)
DescriptionOrnithorhynchus anatinus miR-1420g stem-loop
Gene family MIPF0000574; mir-1420
Stem-loop
   ------uu   u    c        c       ga   --c      -     
5'         gcu aauc agccuauc ggccugg  gca   ucucua guga 
           ||| |||| |||||||| |||||||  |||   |||||| ||| u
3'         cgg uugg uuggguag cuggacc  cgu   aggggu caua 
   ucgucacu   -    u        a       ac   uaa      a     
Get sequence
Deep sequencing
23 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig198872: 189-283 [-]
intergenic
Clustered miRNAs
< 10kb from oan-mir-1420g
oan-mir-1420gContig198872: 189-283 [-]
oan-mir-1420fContig198872: 51-159 [-]
Database links

Mature sequence oan-miR-1420g-5p

Accession MIMAT0007318
Previous IDsoan-miR-1420g
Sequence

17 - 

auccggccugggagcacucucu

 - 38

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-1420g-3p

Accession MIMAT0007319
Previous IDsoan-miR-1420g*
Sequence

55 - 

aaauugccaccaggucagaugg

 - 76

Get sequence
Deep sequencing17 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).