Stem-loop sequence gma-MIR1532

AccessionMI0007251 (change log)
DescriptionGlycine max miR1532 stem-loop
Stem-loop
   ------ucaacuca         g        agcgcgugcuaaacgagacguuaagcacgagagucagaauccguua 
5'               uucucucgc uagcgugu                                              c
                 ||||||||| ||||||||                                               
3'               aggagagcg aucgcaca                                              u
   acacgaaucgcucg         a        agacacagucaaaacaggugaaucagacacgacacgcgacacgcgc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr13: 43766192-43766343 [+]
intergenic
Database links

Mature sequence gma-miR1532

Accession MIMAT0007394
Sequence

120 - 

aacacgcuaagcgagaggagcuc

 - 142

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).