Stem-loop sequence gga-mir-1702

AccessionMI0007437 (change log)
DescriptionGallus gallus miR-1702 stem-loop
Stem-loop
     u    ga  -c             ugu     ucug   gcu 
5' ac ccag  gc  acaguuugcucug   gugca    ggu   g
   || ||||  ||  |||||||||||||   |||||    |||    
3' ug gguc  cg  ugucgagcgagac   uacgu    ccg   a
     u    -a  uu             --u     --ua   aac 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr13: 2077696-2077779 [+]
sense
ENSGALT00000041241 ; PCDH1-201; intron 4
Database links

Mature sequence gga-miR-1702

Accession MIMAT0007594
Sequence

52 - 

auugcauucagagcgagcugu

 - 72

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).