Stem-loop sequence gga-mir-1710

AccessionMI0007447 (change log)
DescriptionGallus gallus miR-1710 stem-loop
Literature search

1 open access papers mention gga-mir-1710
(12 sentences)

Stem-loop
       -a     a     a      -   uaa    c  gu 
5' aacc  gcugc auuuc ucugcu gca   ccau ca  a
   ||||  ||||| ||||| |||||| |||   |||| ||  a
3' uugg  ugacg uaagg agacgg cgu   ggua gu  u
       ag     g     -      u   cuc    c  au 
Get sequence
Deep sequencing
15 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr5: 27886399-27886478 [+]
intergenic
Database links

Mature sequence gga-miR-1710

Accession MIMAT0007605
Sequence

15 - 

ucaucugcugcauaaccaucca

 - 36

Get sequence
Deep sequencing10 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).