Stem-loop sequence gga-mir-1713

AccessionMI0007450 (change log)
DescriptionGallus gallus miR-1713 stem-loop
Stem-loop
       aaa  ac        -  c  c    --g   g   aa    ugug 
5' cuug   au  cccucccg gc cc cguu   ccc cuc  aguc    a
   ||||   ||  |||||||| || || ||||   ||| |||  ||||    c
3' gaac   ua  gggagggc cg gg gcaa   ggg gag  ucgg    a
       -cg  ga        u  u  c    gaa   a   gc    uuga 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr7: 16338832-16338930 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-1713
gga-mir-10bchr7: 16343590-16343699 [-]
gga-mir-1713chr7: 16338832-16338930 [-]
Database links

Mature sequence gga-miR-1713

Accession MIMAT0007609
Sequence

57 - 

cucggagagggaagaacgcggug

 - 79

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).