Stem-loop sequence gga-mir-1721

AccessionMI0007458 (change log)
DescriptionGallus gallus miR-1721 stem-loop
Stem-loop
      ua     u     ---ug     -g    g  a  c 
5' ggg  aguau uuagg     guuau  cugu cc cc a
   |||  ||||| |||||     |||||  |||| || ||  
3' ccc  ucgug agucu     uagua  gaca gg gg g
      ug     u     gguug     ga    -  -  g 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr8: 5006769-5006842 [-]
intergenic
Database links

Mature sequence gga-miR-1721

Accession MIMAT0007619
Sequence

45 - 

agagaugauguuggucugaug

 - 65

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).