Stem-loop sequence gga-mir-1761

AccessionMI0007503 (change log)
DescriptionGallus gallus miR-1761 stem-loop
Stem-loop
   u       uuauu    -g   c   uuuu  uu   aaaaa 
5'  uguacuu     ucag  ggu acu    ug  uuc     a
    |||||||     ||||  ||| |||    ||  |||      
3'  acaugag     aguc  cca ugg    ac  aag     a
   g       -uugu    aa   u   ---c  uu   aaaaa 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr8: 16867543-16867623 [-]
antisense
Database links

Mature sequence gga-miR-1761

Accession MIMAT0007668
Sequence

15 - 

caggggucacuuuuuuguuu

 - 34

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).