Stem-loop sequence gga-mir-1774

AccessionMI0007517 (change log)
DescriptionGallus gallus miR-1774 stem-loop
Stem-loop
   gggaaucuaacccgua        g gc       a   --  u  u 
5'                 aagcaggg c  cagcagg ggu  gc ug u
                   |||||||| |  ||||||| |||  || ||  
3'                 uucgucuu g  gucgucc ccg  ug ac c
   -------------cuc        g -a       -   uc  u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr28: 1360673-1360751 [+]
sense
Database links

Mature sequence gga-miR-1774

Accession MIMAT0007685
Sequence

57 - 

ccccugcugagguucugcuuc

 - 77

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).