Stem-loop sequence gga-mir-1791

AccessionMI0007534 (change log)
DescriptionGallus gallus miR-1791 stem-loop
Gene family MIPF0001396; mir-1791
Stem-loop
   u  a   c     ug g             gc a     ug 
5'  ga gca caugu  g cugcaucagucau  c uguua  a
    || ||| |||||  | |||||||||||||  | |||||  a
3'  cu ugu gugca  c gacguagucagug  g gcaau  a
   a  g   a     gu g             ua c     cc 
Get sequence
Deep sequencing
282 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr11: 9086638-9086722 [+]
sense
ENSGALT00000034103 ; ZNF536-201; intron 4
Database links

Mature sequence gga-miR-1791-5p

Accession MIMAT0007704
Previous IDsgga-miR-1791*
Sequence

14 - 

ugggcugcaucagucaugccaug

 - 36

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-1791-3p

Accession MIMAT0007705
Previous IDsgga-miR-1791
Sequence

51 - 

gcgaugugacugaugcaggcug

 - 72

Get sequence
Deep sequencing278 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).