Stem-loop sequence gga-mir-1811

AccessionMI0007556 (change log)
DescriptionGallus gallus miR-1811 stem-loop
Literature search

1 open access papers mention gga-mir-1811
(2 sentences)

Stem-loop
     ug    -    u   g                --   au 
5' gc  acau gguu auu cagcgcugggugcaug  gag  c
   ||  |||| |||| ||| ||||||||||||||||  |||  u
3' cg  ugua ccaa uaa gucgcgacccacgugc  uuc  u
     gu    a    -   a                ga   ac 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 57456663-57456743 [+]
antisense
ENSGALT00000019679 ; LARP7-201; intron 8
Clustered miRNAs
< 10kb from gga-mir-1811
gga-mir-302bchr4: 57456279-57456350 [+]
gga-mir-302cchr4: 57456541-57456605 [+]
gga-mir-1811chr4: 57456663-57456743 [+]
gga-mir-302achr4: 57456844-57456910 [+]
gga-mir-302dchr4: 57457179-57457247 [+]
gga-mir-367chr4: 57457315-57457387 [+]
Database links

Mature sequence gga-miR-1811

Accession MIMAT0007729
Sequence

13 - 

uauugcagcgcugggugcau

 - 32

Get sequence
Deep sequencing7 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).