Stem-loop sequence osa-MIR1877

AccessionMI0008283 (change log)
DescriptionOryza sativa miR1877 stem-loop
Literature search

2 open access papers mention osa-MIR1877
(7 sentences)

Stem-loop
          a    cg                  gc ug         c     u     aaaaaa         aucaacu                      uaacuucauaaacaugcaaguuaaaauua 
5' auucuaa cucu  aggggacauucucucauu  u  caugucauc aaaug uuaug      uuaaaaaaa       ggauagauuaauaugugauaga                             a
   ||||||| ||||  ||||||||||||||||||  |  ||||||||| ||||| |||||      |||||||||       ||||||||||||||||||||||                             a
3' uaagauu gaga  ucuccuguaggggaguag  a  guacaguag uuuac aauau      aauuuuuuu       uuuaucuaauuauacacuaucu                             c
          c    --                  ua gu         a     c     aaaaaa         --auuau                      aaucaacaucaaaaaacguugaacaucuu 
Get sequence
Deep sequencing
106 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr9: 21043873-21044133 [+]
intergenic
Database links

Mature sequence osa-miR1877

Accession MIMAT0007834
Sequence

217 - 

agaugacaugugaaugaugagggg

 - 240

Get sequence
Deep sequencing82 reads, 2 experiments
Evidence experimental; 454 [1]

References

1
PMID:18687877 "A diverse set of microRNAs and microRNA-like small RNAs in developing rice grains" Zhu QH, Spriggs A, Matthew L, Fan L, Kennedy G, Gubler F, Helliwell C Genome Res. 18:1456-1465(2008).