Stem-loop sequence mmu-mir-1894

AccessionMI0008326 (change log)
Symbol MGI:Mir1894
DescriptionMus musculus miR-1894 stem-loop
Literature search

2 open access papers mention mmu-mir-1894
(39 sentences)

Stem-loop
   ucuuu   cu       cuac     g -     c      g 
5'      guu  cucuccc    caccu c cucuu ccugcu u
        |||  |||||||    ||||| | ||||| ||||||  
3'      cga  gggaggg    guggg g gggaa ggacga g
   --gac   cc       --aa     a a     c      g 
Get sequence
Deep sequencing
15 reads, 33.3 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr17: 35917889-35917969 [+]
sense
OTTMUST00000049786 ; Ppp1r10-001; intron 2
OTTMUST00000049790 ; Ppp1r10-002; exon 2
OTTMUST00000049793 ; Ppp1r10-005; intron 2
ENSMUST00000087210 ; Ppp1r10-201; intron 1
ENSMUST00000087211 ; Ppp1r10-001; intron 2
ENSMUST00000133641 ; Ppp1r10-002; exon 2
ENSMUST00000151664 ; Ppp1r10-005; intron 2
Database links

Mature sequence mmu-miR-1894-5p

Accession MIMAT0007877
Sequence

11 - 

cucuccccuaccaccugccucu

 - 32

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; microarray [1], PCR [1]
Predicted targets

Mature sequence mmu-miR-1894-3p

Accession MIMAT0007878
Sequence

50 - 

gcaagggagagggugaagggag

 - 71

Get sequence
Deep sequencing10 reads, 9 experiments
Evidence experimental; microarray [1], PCR [1]
Predicted targets

References

1
PMID:18492288 "MicroRNA-encoding long non-coding RNAs" He S, Su H, Liu C, Skogerbo G, He H, He D, Zhu X, Liu T, Zhao Y, Chen R BMC Genomics. 9:236(2008).