Stem-loop sequence ptr-mir-1272

AccessionMI0008473 (change log)
DescriptionPan troglodytes miR-1272 stem-loop
Gene family MIPF0000645; mir-1272
Stem-loop
   -    au      --u   ug g    u aug     ---a a      --aa   u   cagug    ua 
5'  ccag  cagauc   ggg  c auga g   gcagc    a uucuga    acg gcu     ucuu  u
    ||||  ||||||   |||  | |||| |   |||||    | ||||||    ||| |||     ||||   
3'  gguc  gucugg   cuc  g ugcu c   cgucg    u aagauu    ugc uga     agga  a
   u    gg      ugu   gu -    - -ga     gaug a      caaa   -   ----a    ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr15: 45605910-45606037 [-]
sense
ENSPTRT00000013220 ; RBPMS2-201; intron 1
Database links

Mature sequence ptr-miR-1272

Accession MIMAT0007993
Sequence

20 - 

gaugaugauggcagcaaauucugaaa

 - 45

Get sequence
Evidence by similarity; MI0006408
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).