Stem-loop sequence ptr-mir-141

AccessionMI0008541 (change log)
Previous IDsptr-mir-141-1
DescriptionPan troglodytes miR-141 stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   -    g    u   u       --    u        -   ugg  ua 
5'  ggcc gccc ggg ccaucuu  ccag acaguguu gga   uc  a
    |||| |||| ||| |||||||  |||| |||||||| |||   ||  u
3'  uugg uggg ccc gguagaa  gguc ugucacaa ccu   ag  u
   c    g    c   c       au    -        u   cga  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr12: 7286482-7286575 [+]
sense
ENSPTRT00000060941 ; ptr-mir-141-1-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-141
ptr-mir-200cchr12: 7286057-7286165 [+]
ptr-mir-141chr12: 7286482-7286575 [+]
Database links

Mature sequence ptr-miR-141

Accession MIMAT0008036
Sequence

58 - 

uaacacugucugguaaagaugg

 - 79

Get sequence
Evidence by similarity; MI0000457
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).