Stem-loop sequence ptr-mir-200a

AccessionMI0008573 (change log)
DescriptionPan troglodytes miR-200a stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   -    - c   g        -            -----------     a 
5'  cggg c ccu ugagcauc uuaccggacagu           gcugg u
    |||| | ||| |||||||| ||||||||||||           ||||| u
3'  gccc g gga acuuguag aauggucuguca           cgacc u
   c    a u   a        c            caaucucaguu     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr1: 355944-356032 [+]
sense
ENSPTRT00000054489 ; ptr-mir-200a-201; exon 1
Database links

Mature sequence ptr-miR-200a

Accession MIMAT0008063
Sequence

53 - 

uaacacugucugguaacgaugu

 - 74

Get sequence
Evidence by similarity; MI0000737
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).