![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ptr-mir-200a |
|||||
Accession | MI0008573 (change log) | ||||
Description | Pan troglodytes miR-200a stem-loop | ||||
Gene family | MIPF0000019; mir-8 | ||||
Stem-loop |
- - c g - ----------- a 5' cggg c ccu ugagcauc uuaccggacagu gcugg u |||| | ||| |||||||| |||||||||||| ||||| u 3' gccc g gga acuuguag aauggucuguca cgacc u c a u a c caaucucaguu c |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence ptr-miR-200a |
|
Accession | MIMAT0008063 |
Sequence |
53 - uaacacugucugguaacgaugu - 74 |
Evidence | by similarity; MI0000737 |
Predicted targets |
|
References |
|
1 |
PMID:18760970
"Computational identification of novel microRNA homologs in the chimpanzee genome"
Comput Biol Chem. 33:62-70(2009).
|