Stem-loop sequence ptr-mir-331

AccessionMI0008622 (change log)
DescriptionPan troglodytes miR-331 stem-loop
Gene family MIPF0000199; mir-331
Stem-loop
   aguuugguuuu         u        u    u       au ccaga 
5'            guuuggguu guucuagg augg cccaggg  c     u
              ||||||||| |||||||| |||| |||||||  |     c
3'            cgaauccaa caagaucc uauc ggguccc  g     a
   ---------cu         c        -    c       cg accaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr12: 98075152-98075244 [+]
sense
ENSPTRT00000054522 ; ptr-mir-331-201; exon 1
Database links

Mature sequence ptr-miR-331

Accession MIMAT0008103
Sequence

60 - 

gccccugggccuauccuagaa

 - 80

Get sequence
Evidence by similarity; MI0000812
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).