Stem-loop sequence ptr-mir-367

AccessionMI0008638 (change log)
DescriptionPan troglodytes miR-367 stem-loop
Gene family MIPF0000162; mir-367
Stem-loop
   c               ua     c    uugaa 
5'  cauuacuguugcuaa  ugcaa ucug     u
    |||||||||||||||  ||||| ||||      
3'  guagugguaacgauu  acguu aggu     a
   -               uc     a    uaaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr4: 115711169-115711235 [-]
sense
ENSPTRT00000054518 ; ptr-mir-367-201; exon 1
antisense
ENSPTRT00000030467 ; LARP7-201; intron 8
Clustered miRNAs
< 10kb from ptr-mir-367
ptr-mir-302bchr4: 115711790-115711861 [-]
ptr-mir-302cchr4: 115711658-115711724 [-]
ptr-mir-302achr4: 115711478-115711545 [-]
ptr-mir-302dchr4: 115711299-115711365 [-]
ptr-mir-367chr4: 115711169-115711235 [-]
Database links

Mature sequence ptr-miR-367

Accession MIMAT0008118
Sequence

44 - 

aauugcacuuuagcaaugguga

 - 65

Get sequence
Evidence by similarity; MI0000775
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).