Stem-loop sequence ptr-mir-490

AccessionMI0008687 (change log)
DescriptionPan troglodytes miR-490 stem-loop
Gene family MIPF0000229; mir-490
Stem-loop
   -     -cc      g    -   aguucauu        c      --         g   caa   u 
5'  ggagg   uugcug uuug gaa        guucgaca caugga  ucuccaggu ggu   guu a
    |||||   |||||| |||| |||        |||||||| ||||||  ||||||||| |||   |||  
3'  ccuuc   ggcgac gaac cuu        cgaguugu guaccu  ggaggucca cca   uag g
   a     aca      -    a   ------gu        c      ca         a   -cg   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr7: 141461802-141461928 [+]
sense
ENSPTRT00000054497 ; ptr-mir-490-201; exon 1
ENSPTRT00000061742 ; CHRM2-201; intron 2
Database links

Mature sequence ptr-miR-490

Accession MIMAT0008165
Sequence

75 - 

caaccuggaggacuccaugcug

 - 96

Get sequence
Evidence by similarity; MI0003125
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).