Stem-loop sequence ptr-mir-527

AccessionMI0008740 (change log)
DescriptionPan troglodytes miR-527 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   -            c  ug           c      guug  u 
5'  cucaggcuguga uc  caaagggaagc cuuucu    uc a
    |||||||||||| ||  ||||||||||| ||||||    || a
3'  gaguuuggcauu ag  guuucccuucg gaaaga    ag a
   a            a  ug           u      --aa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 56101441-56101526 [+]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-527
ptr-mir-521-1chr19: 56096062-56096147 [+]
ptr-mir-522chr19: 56098628-56098713 [+]
ptr-mir-519fchr19: 56099801-56099908 [+]
ptr-mir-527chr19: 56101441-56101526 [+]
ptr-mir-516a-1chr19: 56104159-56104247 [+]
ptr-mir-1283bchr19: 56105638-56105756 [+]
ptr-mir-516a-2chr19: 56108558-56108646 [+]
ptr-mir-519achr19: 56109768-56109853 [+]
Database links

Mature sequence ptr-miR-527

Accession MIMAT0008212
Sequence

15 - 

cugcaaagggaagcccuuuc

 - 34

Get sequence
Evidence by similarity; MI0003179
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).