Stem-loop sequence ptr-mir-615

AccessionMI0008814 (change log)
DescriptionPan troglodytes miR-615 stem-loop
Gene family MIPF0000342; mir-615
Stem-loop
   cuc   ag   c          -uc     u        cu    g ug 
5'    ggg  ggg gggagggggg   cccgg gcucggau  cgag g  c
      |||  ||| ||||||||||   ||||| ||||||||  |||| |  u
3'    ccc  ccc cccuucuccc   ggguc cgagccug  gcuu u  u
   -cc   aa   -          ucu     -        --    g ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr12: 35743356-35743450 [-]
sense
ENSPTRT00000009260 ; HOXC4-201; intron 1
ENSPTRT00000009261 ; HOXC5-201; intron 1
ENSPTRT00000054781 ; ptr-mir-615-201; exon 1
Database links

Mature sequence ptr-miR-615

Accession MIMAT0008277
Sequence

61 - 

uccgagccugggucucccucuu

 - 82

Get sequence
Evidence by similarity; MI0003628
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).