Stem-loop sequence ptr-mir-643

AccessionMI0008834 (change log)
DescriptionPan troglodytes miR-643 stem-loop
Gene family MIPF0000488; mir-643
Stem-loop
   ccaaguga      u   g            a         --g    c 
5'         uauuca ugu uaccugagcuag auacaagug   uugg g
           |||||| ||| |||||||||||| |||||||||   |||| u
3'         guaagu aua auggacucgauc uauguucac   gacu c
   ---aaaaa      u   g            g         aga    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 54549139-54549234 [+]
sense
ENSPTRT00000074275 ; ZNF766-201; intron 1
Database links

Mature sequence ptr-miR-643

Accession MIMAT0008297
Sequence

60 - 

acuuguaugcuagcucagguag

 - 81

Get sequence
Evidence by similarity; MI0003658
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).