Stem-loop sequence ptr-mir-658

AccessionMI0008844 (change log)
DescriptionPan troglodytes miR-658 stem-loop
Gene family MIPF0000643; mir-658
Stem-loop
   g    g  g   --      -      --cgg   gc     --agc   c  a 
5'  cucg uu ccg  ugguug cgggcc     ccc  ccgcc     ucg ug c
    |||| || |||  |||||| ||||||     |||  |||||     ||| ||  
3'  gagc aa ggu  gccggu gccugg     ggg  ggcgg     agc ac a
   -    -  g   ug      u      augaa   -a     gacuc   -  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr22: 24390227-24390325 [-]
sense
ENSPTRT00000026814 ; ANKRD54-201; 5'UTR (exon 1)
Database links

Mature sequence ptr-miR-658

Accession MIMAT0008307
Sequence

61 - 

ggcggagggaaguagguccguugg

 - 84

Get sequence
Evidence by similarity; MI0003682
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).