Stem-loop sequence ptr-mir-939

AccessionMI0008886 (change log)
DescriptionPan troglodytes miR-939 stem-loop
Gene family MIPF0000490; mir-939
Stem-loop
   u    gca    c         u     u ug   gu   c 
5'  gugg   gggc cuggggagc gaggc c  ggg  ggc g
    ||||   |||| ||||||||| ||||| |  |||  |||  
3'  cgcc   ucug gaccccucg cuccg g  ccc  ucg g
   -    -ag    u         u     - gu   ag   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr8: 147198286-147198366 [-]
sense
ENSPTRT00000063564 ; ptr-mir-939-201; exon 1
KV421069.1: 103535-103615 [+]
sense
ENSPTRT00000063564 ; ptr-mir-939-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-939
ptr-mir-1234chr8: 147204753-147204825 [-]
ptr-mir-939chr8: 147198286-147198366 [-]
Database links

Mature sequence ptr-miR-939

Accession MIMAT0008346
Sequence

15 - 

uggggagcugaggcucugggggug

 - 38

Get sequence
Evidence by similarity; MI0005761
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).