Stem-loop sequence dan-mir-92b

AccessionMI0008942 (change log)
DescriptionDrosophila ananassae miR-92b stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   ac u   - uga         u c cg    uu      uacuu 
5'   g cac c   uguaggccg g c  gugc  auuugu     u
     | ||| |   ||||||||| | |  ||||  ||||||     u
3'   c gug g   acguccggc c g  cacg  uaaaca     g
   aa u   a -ug         c u au    -u      uaaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dana_r1.3_FB2010_03) Overlapping transcripts
scaffold_13340: 3732646-3732733 [+]
intergenic
Clustered miRNAs
< 10kb from dan-mir-92b
dan-mir-92ascaffold_13340: 3727777-3727863 [+]
dan-mir-92bscaffold_13340: 3732646-3732733 [+]
Database links

Mature sequence dan-miR-92b

Accession MIMAT0008405
Sequence

55 - 

aauugcacuagucccggccugc

 - 76

Get sequence
Evidence by similarity; MI0000379

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).