Stem-loop sequence der-mir-281-2

AccessionMI0009040 (change log)
DescriptionDrosophila erecta miR-281-2 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
        u  gaa ug        -ua     c      caagu    a 
5' cgaau gu   a  aagagagc   uccgu gacagu     uaau c
   ||||| ||   |  ||||||||   ||||| ||||||     ||||  
3' gcuua ca   u  uucucucg   aggua cuguca     guua c
        -  aua gu        uua     -      -uaau    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dere_r1.3_FB2010_02) Overlapping transcripts
scaffold_4845: 17736415-17736506 [+]
intergenic
Clustered miRNAs
< 10kb from der-mir-281-2
der-mir-281-1scaffold_4845: 17736197-17736286 [+]
der-mir-281-2scaffold_4845: 17736415-17736506 [+]
Database links

Mature sequence der-miR-281-2-5p

Accession MIMAT0009183
Previous IDsder-miR-281-2*
Sequence

15 - 

aagagagcuauccgucgacagu

 - 36

Get sequence
Evidence by similarity; MI0000370

Mature sequence der-miR-281-3p

Accession MIMAT0008502
Previous IDsder-miR-281
Sequence

60 - 

ugucauggaauugcucucuuugu

 - 82

Get sequence
Evidence by similarity; MI0000366

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).