Stem-loop sequence der-mir-305

AccessionMI0009067 (change log)
DescriptionDrosophila erecta miR-305 stem-loop
Gene family MIPF0000158; mir-305
Stem-loop
        cu u         u  g     cu  u  ggu 
5' caugu  a uguacuuca ca gugcu  gg gu   c
   |||||  | ||||||||| || |||||  || ||    
3' guaua  u acaugaagu gu cacgg  cc ca   c
        ac c         u  a     --  -  aug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dere_r1.3_FB2010_02) Overlapping transcripts
scaffold_4929: 16344698-16344770 [+]
intergenic
Clustered miRNAs
< 10kb from der-mir-305
der-mir-275scaffold_4929: 16344525-16344614 [+]
der-mir-305scaffold_4929: 16344698-16344770 [+]
Database links

Mature sequence der-miR-305

Accession MIMAT0008527
Sequence

8 - 

auuguacuucaucaggugcucug

 - 30

Get sequence
Evidence by similarity; MI0000412

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).