Stem-loop sequence dgr-mir-305

AccessionMI0009101 (change log)
DescriptionDrosophila grimshawi miR-305 stem-loop
Gene family MIPF0000158; mir-305
Stem-loop
        cu u         u  g     cu   guca 
5' caugu  a uguacuuca ca gugcu  ggu    c
   |||||  | ||||||||| || |||||  |||     
3' guaua  u acaugaagu gu cacgg  cca    u
        ac c         u  a     -c   augc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dgri_r1.3_FB2010_02) Overlapping transcripts
scaffold_15126: 5008545-5008617 [+]
intergenic
Clustered miRNAs
< 10kb from dgr-mir-305
dgr-mir-275scaffold_15126: 5008401-5008492 [+]
dgr-mir-305scaffold_15126: 5008545-5008617 [+]
Database links

Mature sequence dgr-miR-305

Accession MIMAT0008558
Sequence

8 - 

auuguacuucaucaggugcucug

 - 30

Get sequence
Evidence by similarity; MI0000412

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).