Stem-loop sequence dmo-mir-92a

AccessionMI0009187 (change log)
DescriptionDrosophila mojavensis miR-92a stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   uc           gc   a     -     u   c    uaccu 
5'   auaaauugcuu  agg cggga aggug caa guuu     u
     |||||||||||  ||| ||||| ||||| ||| ||||     u
3'   uauuuggcgag  ucc gcccu uucac guu caaa     u
   uc           ua   g     g     -   a    cuuag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6540: 25734566-25734654 [-]
intergenic
Clustered miRNAs
< 10kb from dmo-mir-92a
dmo-mir-92ascaffold_6540: 25734566-25734654 [-]
dmo-mir-92bscaffold_6540: 25731653-25731743 [-]
Database links

Mature sequence dmo-miR-92a

Accession MIMAT0008633
Sequence

55 - 

cauugcacuugucccggccuau

 - 76

Get sequence
Evidence by similarity; MI0000357

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).