Stem-loop sequence dmo-mir-305

AccessionMI0009199 (change log)
DescriptionDrosophila mojavensis miR-305 stem-loop
Gene family MIPF0000158; mir-305
Stem-loop
        cu u         u  g     cu   g  a 
5' caugu  a uguacuuca ca gugcu  ggu uc g
   |||||  | ||||||||| || |||||  ||| ||  
3' guaua  u acaugaagu gu cacgg  cca ag u
        ac c         u  a     -c   a  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dmoj_r1.3_FB2010_02) Overlapping transcripts
scaffold_6500: 18399264-18399336 [-]
intergenic
Clustered miRNAs
< 10kb from dmo-mir-305
dmo-mir-275scaffold_6500: 18399400-18399491 [-]
dmo-mir-305scaffold_6500: 18399264-18399336 [-]
Database links

Mature sequence dmo-miR-305

Accession MIMAT0008646
Sequence

8 - 

auuguacuucaucaggugcucug

 - 30

Get sequence
Evidence by similarity; MI0000412

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).