Stem-loop sequence dpe-mir-92b

AccessionMI0009314 (change log)
DescriptionDrosophila persimilis miR-92b stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   aa  u   -  ga         u c c     uu      c   gu 
5'   cg cac cu  uguaggccg g c agugc  auuugu guu  u
     || ||| ||  ||||||||| | | |||||  |||||| |||  u
3'   gc gug ga  acguccggc c g ucacg  uaaaca uaa  g
   ac  u   a  -g         c u a     -u      -   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dper_r1.3_FB2010_02) Overlapping transcripts
scaffold_3: 6405664-6405754 [-]
intergenic
Clustered miRNAs
< 10kb from dpe-mir-92b
dpe-mir-92ascaffold_3: 6410324-6410408 [-]
dpe-mir-92bscaffold_3: 6405664-6405754 [-]
Database links

Mature sequence dpe-miR-92b

Accession MIMAT0008756
Sequence

57 - 

aauugcacuagucccggccugc

 - 78

Get sequence
Evidence by similarity; MI0000379

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).