Stem-loop sequence dse-mir-311

AccessionMI0009361 (change log)
DescriptionDrosophila sechellia miR-311 stem-loop
Gene family MIPF0000566; mir-310
Stem-loop
      a    au       -a    au   a u      u   uu 
5' ucu gaua  uuuucgg  cggu  aug g caaugu uuc  u
   ||| ||||  |||||||  ||||  ||| | |||||| |||   
3' aga cuau  aaaaguc  gcca  uac c guuaua aag  u
      a    --       cg    cu   a -      u   cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsec_r1.3_FB2010_02) Overlapping transcripts
scaffold_1: 14025606-14025689 [-]
intergenic
Clustered miRNAs
< 10kb from dse-mir-311
dse-mir-992scaffold_1: 14027554-14027612 [-]
dse-mir-991scaffold_1: 14027438-14027499 [-]
dse-mir-2498ascaffold_1: 14026948-14027011 [-]
dse-mir-2498bscaffold_1: 14026439-14026497 [-]
dse-mir-313scaffold_1: 14025902-14025967 [-]
dse-mir-312scaffold_1: 14025763-14025828 [-]
dse-mir-311scaffold_1: 14025606-14025689 [-]
dse-mir-310scaffold_1: 14025480-14025568 [-]
Database links

Mature sequence dse-miR-311-5p

Accession MIMAT0037343
Sequence

15 - 

cggacgguauaugagucaauguu

 - 37

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dse-miR-311-3p

Accession MIMAT0008799
Sequence

52 - 

uauugcacauucaccggccuga

 - 73

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).