Stem-loop sequence dsi-mir-313

AccessionMI0009439 (change log)
DescriptionDrosophila simulans miR-313 stem-loop
Gene family MIPF0000566; mir-310
Stem-loop
   --uucu    c c uu  g   c    --    u 
5'       gcug g a  gg gca uacu  guuu u
         |||| | |  || ||| ||||  |||| u
3'       cgac c u  uc cgu auga  uaaa u
   aaauuc    a - uu  a   u    gu    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr2R: 15132988-15133053 [-]
intergenic
Clustered miRNAs
< 10kb from dsi-mir-313
dsi-mir-992chr2R: 15134519-15134598 [-]
dsi-mir-991chr2R: 15134391-15134508 [-]
dsi-mir-2498cchr2R: 15134038-15134093 [-]
dsi-mir-2498achr2R: 15133881-15133941 [-]
dsi-mir-2498bchr2R: 15133515-15133573 [-]
dsi-mir-313chr2R: 15132988-15133053 [-]
dsi-mir-312chr2R: 15132849-15132914 [-]
dsi-mir-311chr2R: 15132682-15132767 [-]
dsi-mir-310chr2R: 15132557-15132645 [-]
Database links

Mature sequence dsi-miR-313-5p

Accession MIMAT0037348
Sequence

4 - 

ugcugcgcauuggggcacuacug

 - 26

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dsi-miR-313-3p

Accession MIMAT0008874
Sequence

43 - 

uauugcacuuuucacagccuua

 - 64

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).