Stem-loop sequence dsi-mir-312

AccessionMI0009440 (change log)
DescriptionDrosophila simulans miR-312 stem-loop
Gene family MIPF0000573; mir-312
Stem-loop
   gu      u    a    g     ucu   uuuu 
5'   uuuggu cguc caag gcaau   gca    u
     |||||| |||| |||| |||||   |||     
3'   aagccg gcag guuc cguua   ugu    a
   uu      -    a    a     ---   ucaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dsim_caf1; GCA_000259055.1) Overlapping transcripts
chr2R: 15132849-15132914 [-]
intergenic
Clustered miRNAs
< 10kb from dsi-mir-312
dsi-mir-992chr2R: 15134519-15134598 [-]
dsi-mir-991chr2R: 15134391-15134508 [-]
dsi-mir-2498cchr2R: 15134038-15134093 [-]
dsi-mir-2498achr2R: 15133881-15133941 [-]
dsi-mir-2498bchr2R: 15133515-15133573 [-]
dsi-mir-313chr2R: 15132988-15133053 [-]
dsi-mir-312chr2R: 15132849-15132914 [-]
dsi-mir-311chr2R: 15132682-15132767 [-]
dsi-mir-310chr2R: 15132557-15132645 [-]
Database links

Mature sequence dsi-miR-312-5p

Accession MIMAT0015282
Previous IDsdsi-miR-312*
Sequence

5 - 

ugguucgucacaagggcaauucu

 - 27

Get sequence
Evidence experimental; Illumina [2-3]

Mature sequence dsi-miR-312-3p

Accession MIMAT0008875
Previous IDsdsi-miR-312
Sequence

43 - 

uauugcacuugagacggccgaa

 - 64

Get sequence
Evidence experimental; Illumina [2-3]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).
3
PMID:24985917 "Diversity of miRNAs, siRNAs, and piRNAs across 25 Drosophila cell lines" Wen J, Mohammed J, Bortolamiol-Becet D, Tsai H, Robine N, Westholm JO, Ladewig E, Dai Q, Okamura K, Flynt AS, Zhang D, Andrews J, Cherbas L, Kaufman TC, Cherbas P, Siepel A, Lai EC Genome Res. 24:1236-1250(2014).