Stem-loop sequence dvi-mir-313

AccessionMI0009485 (change log)
DescriptionDrosophila virilis miR-313 stem-loop
Gene family MIPF0000566; mir-310
Stem-loop
   -             uc    u    u   uuuuuu 
5'  uuuucggcugugg  agug caau cuu      u
    |||||||||||||  |||| |||| |||      a
3'  aaaggccggcacu  ucac guua gaa      u
   a             uu    -    u   cauuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (DroVir3) Overlapping transcripts
scaffold_12875: 13669117-13669187 [-]
intergenic
Clustered miRNAs
< 10kb from dvi-mir-313
dvi-mir-313scaffold_12875: 13669117-13669187 [-]
dvi-mir-311scaffold_12875: 13668884-13668990 [-]
dvi-mir-310scaffold_12875: 13668747-13668822 [-]
Database links

Mature sequence dvi-miR-313-5p

Accession MIMAT0032050
Sequence

4 - 

ucggcuguggucagugucaauu

 - 25

Get sequence
Evidence experimental; Illumina [2]

Mature sequence dvi-miR-313-3p

Accession MIMAT0008918
Previous IDsdvi-miR-313
Sequence

47 - 

uauugcacuuuucacggccgga

 - 68

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).
2
PMID:24448446 "Fast-evolving microRNAs are highly expressed in the early embryo of Drosophila virilis" Ninova M, Ronshaugen M, Griffiths-Jones S RNA. 20:360-372(2014).