Stem-loop sequence dwi-mir-92b

AccessionMI0009558 (change log)
DescriptionDrosophila willistoni miR-92b stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   ua  u   a  a     a   u c       uu      ugcuau 
5'   cg cac ug uguag ccg g cuggugc  auuugu      u
     || ||| || ||||| ||| | |||||||  ||||||       
3'   gc gug au acguc ggc c gaucacg  uaaaca      u
   ac  u   a  g     c   c u       -u      uauaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dwil_r1.3_FB2010_02) Overlapping transcripts
scf2_1100000004943: 14574166-14574256 [-]
intergenic
Clustered miRNAs
< 10kb from dwi-mir-92b
dwi-mir-92ascf2_1100000004943: 14578432-14578512 [-]
dwi-mir-92bscf2_1100000004943: 14574166-14574256 [-]
Database links

Mature sequence dwi-miR-92b

Accession MIMAT0008991
Sequence

57 - 

aauugcacuagucccggccugc

 - 78

Get sequence
Evidence by similarity; MI0000379

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).