Stem-loop sequence dwi-mir-281-2

AccessionMI0009561 (change log)
DescriptionDrosophila willistoni miR-281-2 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
         gcg a ug        -ua     c      ---c      aau 
5' cgaaua   a a  aagagagc   uccgu gacagu    caguuu   a
   ||||||   | |  ||||||||   ||||| ||||||    ||||||   c
3' gcuuau   u u  uucucucg   aggua cuguca    guuaag   a
         -aa a gu        uua     -      uaau      ccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dwil_r1.3_FB2010_02) Overlapping transcripts
scf2_1100000004954: 3242070-3242166 [+]
intergenic
Clustered miRNAs
< 10kb from dwi-mir-281-2
dwi-mir-281-1scf2_1100000004954: 3241883-3241972 [+]
dwi-mir-281-2scf2_1100000004954: 3242070-3242166 [+]
Database links

Mature sequence dwi-miR-281-2-5p

Accession MIMAT0009189
Previous IDsdwi-miR-281-2*
Sequence

15 - 

aagagagcuauccgucgacagu

 - 36

Get sequence
Evidence by similarity; MI0000370

Mature sequence dwi-miR-281-3p

Accession MIMAT0008995
Previous IDsdwi-miR-281
Sequence

65 - 

ugucauggaauugcucucuuugu

 - 87

Get sequence
Evidence by similarity; MI0000366

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).