Stem-loop sequence dwi-mir-92a

AccessionMI0009564 (change log)
DescriptionDrosophila willistoni miR-92a stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   --   uu        a     -     u   c    ugccu 
5'   aau  cucguagg cggga aggug caa guuu     u
     |||  |||||||| ||||| ||||| ||| ||||     a
3'   uug  gaguaucc gcccu uucac guu caaa     u
   gu   gc        g     g     -   a    cuaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dwil_r1.3_FB2010_02) Overlapping transcripts
scf2_1100000004943: 14578432-14578512 [-]
intergenic
Clustered miRNAs
< 10kb from dwi-mir-92a
dwi-mir-92ascf2_1100000004943: 14578432-14578512 [-]
dwi-mir-92bscf2_1100000004943: 14574166-14574256 [-]
Database links

Mature sequence dwi-miR-92a

Accession MIMAT0008998
Sequence

50 - 

cauugcacuugucccggccuau

 - 71

Get sequence
Evidence by similarity; MI0000357

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).