Stem-loop sequence dya-mir-305

AccessionMI0009640 (change log)
DescriptionDrosophila yakuba miR-305 stem-loop
Gene family MIPF0000158; mir-305
Stem-loop
        cu u         u  g     cu  u  ggc 
5' caugu  a uguacuuca ca gugcu  gg gu   c
   |||||  | ||||||||| || |||||  || ||    
3' guaua  u acaugaagu gu cacgg  cc ca   c
        ac c         u  a     --  -  aug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr2L: 5473629-5473701 [-]
intergenic
Clustered miRNAs
< 10kb from dya-mir-305
dya-mir-275chr2L: 5473787-5473876 [-]
dya-mir-305chr2L: 5473629-5473701 [-]
Database links

Mature sequence dya-miR-305

Accession MIMAT0009067
Sequence

8 - 

auuguacuucaucaggugcucug

 - 30

Get sequence
Evidence by similarity; MI0000412

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).