Stem-loop sequence dya-mir-287

AccessionMI0009677 (change log)
DescriptionDrosophila yakuba miR-287 stem-loop
Gene family MIPF0000224; mir-287
Stem-loop
   guaugggugugggucugaaauuuugcacacau       aau        ugu g 
5'                                 uuacagu   uguaaaug   u a
                                   |||||||   ||||||||   |  
3'                                 aguguca   acguuugc   a a
   --------------------------------       -gu        --u a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr2R: 3525130-3525206 [-]
intergenic
Clustered miRNAs
< 10kb from dya-mir-287
dya-mir-124chr2R: 3533191-3533271 [-]
dya-mir-287chr2R: 3525130-3525206 [-]
Database links

Mature sequence dya-miR-287

Accession MIMAT0009102
Sequence

49 - 

uguguugaaaaucguuugcau

 - 69

Get sequence
Evidence by similarity; MI0000381

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).