Stem-loop sequence dya-mir-92a

AccessionMI0009688 (change log)
DescriptionDrosophila yakuba miR-92a stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   aa  ug   uu        a     -     u   c    -ug a 
5'   ua  aau  cccguagg cggga aggug caa guuu   c u
     ||  |||  |||||||| ||||| ||||| ||| ||||   | u
3'   au  uug  ggguaucc gcccu uucac guu caaa   g u
   ua  gu   gc        g     g     -   a    uaa u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dyak_caf1; GCA_000005975.1) Overlapping transcripts
chr3R: 25001380-25001469 [-]
intergenic
Clustered miRNAs
< 10kb from dya-mir-92a
dya-mir-92achr3R: 25001380-25001469 [-]
dya-mir-92bchr3R: 24996466-24996556 [-]
Database links

Mature sequence dya-miR-92a

Accession MIMAT0009111
Sequence

55 - 

cauugcacuugucccggccuau

 - 76

Get sequence
Evidence by similarity; MI0000357

References

1
PMID:17994087 "Evolution of genes and genomes on the Drosophila phylogeny" Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, Kaufman TC, Kellis M, Gelbart W, Iyer VN, Pollard DA, Sackton TB, Larracuente AM, Singh ND, Abad JP, Abt DN, Adryan B, Aguade M, Akashi H, Anderson WW, Aquadro CF, Ardell DH, Arguello R, Artie Nature. 450:203-218(2007).