Stem-loop sequence bmo-mir-92b

AccessionMI0009998 (change log)
Previous IDsbmo-mir-92
DescriptionBombyx mori miR-92b stem-loop
Gene family MIPF0000013; mir-25
Literature search

5 open access papers mention bmo-mir-92b
(18 sentences)

Stem-loop
     g         cu    a  c    a       acguu      
5' gc guggccacg  uagg cg gauu gguguaa     ugugu 
   || |||||||||  |||| || |||| |||||||     |||| u
3' cg caccggugu  gucc gc cuaa ccacguu     auacu 
     a         cc    g  c    -       aaacu      
Get sequence
Deep sequencing
14 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581739.1: 696074-696161 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-92b
bmo-mir-92aNW_004581739.1: 696247-696327 [-]
bmo-mir-92bNW_004581739.1: 696074-696161 [-]
Database links

Mature sequence bmo-miR-92b

Accession MIMAT0009155
Previous IDsbmo-miR-92
Sequence

54 - 

aauugcaccaaucccggccugc

 - 75

Get sequence
Deep sequencing14 reads, 3 experiments
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).