Accession | MIMAT0009199 |
Description | hsa-miR-365a-5p mature miRNA |
Hairpins | |
Sequence | AGGGACUUUUGGGGGCAGAUGUG |
Evidence | not_experimental |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
located_in | GO:1903561 extracellular vesicle |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:28798470 | produced_by CL:0000182 |