Stem-loop sequence bfl-mir-200c

AccessionMI0010037 (change log)
DescriptionBranchiostoma floridae miR-200c stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   aucuaac   -        g       -     u     gu      ggu 
5'        aug gcggaguu ugucauc uuacc ggcag  uuagau   u
          ||| |||||||| ||||||| ||||| |||||  ||||||   c
3'        uac cgccucag gcaguag aaugg cuguc  aaucua   u
   ------a   a        g       u     u     ac      ggg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2; GCF_000003815.1) Overlapping transcripts
GG666627.1: 358765-358859 [-]
intergenic
Clustered miRNAs
< 10kb from bfl-mir-200c
bfl-mir-200aGG666627.1: 361501-361601 [-]
bfl-mir-200cGG666627.1: 358765-358859 [-]
bfl-mir-200bGG666627.1: 355968-356065 [-]
Database links

Mature sequence bfl-miR-200c

Accession MIMAT0009493
Sequence

58 - 

uaacacugucugguaaugaug

 - 78

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).