Stem-loop sequence cte-mir-92a

AccessionMI0010064 (change log)
Previous IDscap-mir-92a
DescriptionCapitella teleta miR-92a stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   uuucgu   u  u  uc  u            a      c     g   ucg 
5'       gcg gu gc  gg gccagaaggucg gauugg gcaau cug   u
         ||| || ||  || |||||||||||| |||||| ||||| |||   c
3'       ugc cg cg  uc cggucuuccggc cugauc cguua gac   c
   ---uuc   u  u  --  u            c      a     -   cua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB294417.1: 594329-594429 [-]
intergenic
Clustered miRNAs
< 10kb from cte-mir-92a
cte-mir-92bKB294417.1: 595219-595319 [-]
cte-mir-92aKB294417.1: 594329-594429 [-]
cte-mir-92cKB294417.1: 594205-594305 [-]
Database links

Mature sequence cte-miR-92a

Accession MIMAT0009520
Previous IDscap-miR-92a
Sequence

61 - 

gauugcacuagucccggccuuc

 - 82

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).