Stem-loop sequence cte-mir-92b

AccessionMI0010065 (change log)
Previous IDscap-mir-92b
DescriptionCapitella teleta miR-92b stem-loop
Stem-loop
   cgc  g c    -u   -     a     c   -        g   -    aa 
5'    au g gucg  uga aucgg ggguc gga uggugcaa uug uuaa  c
      || | ||||  ||| ||||| ||||| ||| |||||||| ||| ||||   
3'    ua c cggc  acu uaguc uccgg ccu gucacguu aac gguu  a
   --a  g -    uc   c     g     c   u        a   u    ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB294417.1: 595219-595319 [-]
intergenic
Clustered miRNAs
< 10kb from cte-mir-92b
cte-mir-92bKB294417.1: 595219-595319 [-]
cte-mir-92aKB294417.1: 594329-594429 [-]
cte-mir-92cKB294417.1: 594205-594305 [-]
Database links

Mature sequence cte-miR-92b

Accession MIMAT0009521
Previous IDscap-miR-92b
Sequence

61 - 

aauugcacuguucccggccugc

 - 82

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).