Stem-loop sequence cte-mir-281

AccessionMI0010084 (change log)
Previous IDscap-mir-281
DescriptionCapitella teleta miR-281 stem-loop
Stem-loop
   acu    gauucaauc  - u       c         -  g     aaac    u 
5'    gcag         gg c ggucguu aggggggca cu caugg    gcua c
      ||||         || | ||||||| ||||||||| || |||||    ||||  
3'    cguu         cc g ccagcaa uucucucgu ga guacu    ugau c
   --g    ------aau  a u       u         u  g     --gu    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Capca1; GCA_000328365.1) Overlapping transcripts
KB310891.1: 24429-24530 [+]
intergenic
Database links

Mature sequence cte-miR-281

Accession MIMAT0009540
Previous IDscap-miR-281
Sequence

62 - 

ugucauggaguugcucucuuua

 - 83

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).