Stem-loop sequence lgi-mir-92

AccessionMI0010116 (change log)
DescriptionLottia gigantea miR-92 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   -cauaa      aaga ga  u        u    uu      a   agaa 
5'       ugaaga    u  gu gcaggucg gaua  ugcaau ugg    g
         ||||||    |  || |||||||| ||||  |||||| |||     
3'       acuucu    a  cg cguccggc cugu  acguua acu    a
   aacucc      ---g aa  u        c    uc      a   aaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Helro1; GCA_000327385.1) Overlapping transcripts
KB202544.1: 43354-43453 [-]
intergenic
Clustered miRNAs
< 10kb from lgi-mir-92
lgi-mir-190KB202544.1: 52934-53034 [-]
lgi-mir-92KB202544.1: 43354-43453 [-]
Database links

Mature sequence lgi-miR-92

Accession MIMAT0009574
Sequence

60 - 

aauugcacuugucccggccugc

 - 81

Get sequence
Evidence not experimental

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).